ࡱ > % ' " # $ 5@ + bjbj22 "^ X X ]i 2r 2r 2r 2r 4 fr d Ζ u p Fv Fv Fv Fv Fv Fv Fv $ R ֙ > Cx Fv Fv Cx Cx Fv Fv Cx
Fv Fv Cx Fv u p3a 2r 6 , 0 Ζ ? : Fv Z v @ v 4 w / Fv Fv Fv @ A D0 y
A Quantitative and Qualitative Differences in Eubacterial and Fungal DNA Extracted from California soils Using Three Common DNA Extraction Methods
Materials and Methods
Soil Samples
Twenty soils of varying physicochemical characteristics were sampled from farms across Southern California (Table 1). All the soils except Powell and Vanoni were stored in sealed plastic bags in a storage shed (diurnal temperature range 10C-40C) for two months prior to use. Powell and Vanoni soils were stored at 4C and used within two days of sampling. Soil samples were sent to the University of California DANR Analytical Laboratory for physicochemical analyses. Soil pH was determined via the saturated paste extract method ADDIN EN.CITE Staff1954227U.S Salinity Laboratory Staff1954pH reading of saturated soil pasteRichards, L ADiagnosis and improvement of saline and alkali soils. USDA Agricultural Handbook 60Washington, D.C.U.S. Government Printing Office(16), organic matter content via potassium dichromate reduction of organic carbon and subsequent spectrophotometric measurement ADDIN EN.CITE Nelson1982237Nelson, D WSommers, L E1982Total carbon, organic carbon and organic matterPage, A LMethods of soil analysis: Part 2. Chemical and microbiological properties. ASA Monograph Number 9.539-579.(10), and soil texture via particle size analysis ADDIN EN.CITE Gee1982247Gee, G WBauer, J W1982Particle-size analysisKlute, AMethods of soil analysis: Part 1. Physical and mineralogical methods. ASA Monograph Number 9(6). All soils were sieved (Tyler mesh no. 100) aseptically, measured into aliquots and kept frozen (-20C) until DNA extraction. Three sieved samples from each soil were weighed, air dried for 3 days and weighed again to provide estimates of water content for each soil.
DNA Extraction
DNA was extracted in duplicate from 0.5 g samples of all twenty soils using three different methods: (i) the FastPrep DNA extraction kit for soil (Bio 101), following the manufacturers protocol, and using a setting of 5.5 for 30 seconds for the FastPrep instrument, the optional spin columns, and resuspending DNA in a final volume of 100 uL of DES (FP); (2) the UltraClean Soil DNA Extraction kit (MoBio), following the manufacturers standard protocol, in which samples are vortexed horizontally for ten minutes (V); and (3) the UltraClean Soil DNA Extraction kit (MoBio), following the manufacturers standard protocol except that instead of vortexing, samples were bead beaten in a FastPrep instrument at a setting of 5.5 for 30 seconds (BB).
DNA was also extracted in duplicate from the Powell soil using the method of Zhou et al. (1995). Soil samples (5 g) were ground to fine powder in a mortar and pestle with liquid nitrogen, suspended in 13.5 mL extraction buffer (100 mM Tris-HCl,100mM sodium EDTA, 100 mM sodium phosphate, 1.5 M NaCl, 1% (w/v) CTAB, pH 8.0), and t r e a t e d w i t h p r o t e i n a s e K ( 1 0 0 L , 1 0 m g / m L ) a t 3 7 C f o r 3 0 m i n u t e s a t 2 2 5 r p m . S a m p l e s w e r e t h e n t r e a t e d w i t h 1 . 5 m L 2 0 % ( w / v ) S D S , i n c u b a t e d a t 6 5 C f o r t w o h o u r s , m i x i n g o c c a s i o n a l l y , t h e n c e n t r i f u g e d a t 6 0 0 0 X g f o r 1 0 m i n . T h e s u p e r n a t a n t w a s r e s e r v e d a nd the pellet extracted twice more with 4.5 mL extraction buffer plus 0.5 mL 20% SDS and a 10 min incubation at 65C. Pooled supernatants for each sample were extracted with an equal volume of 24:1 chloroform:isoamyl alcohol, then centrifuged 5 mins at 4,400 X g. The aqueous phase (20 mL) was recovered, 12 mL isopropanol added and the mixture left to precipitate 1 hour at room temperature before centrifugation at 16,000 X g for 20 min at room temperature. Pellets were washed with 40 mL cold 70% ethanol and resuspended in 1 mL sterile deionized water. Samples of each DNA extract (40uL) were concentrated to half their original volume and then run in a 10 mL 1% agarose gel for 45 min at 100V. Bands of high molecular weight DNA were excised and the DNA recovered using a MinElute DNA Extraction kit (Qiagen).
Amplification of rDNA for densitometry studies
The concentration of DNA in all soil DNA extracts was determined against a standard curve (0-1000 ng DNA) via fluorometry using Hoeschts dye and a BioRad VersaFluor fluorometer. Extracts from different subsamples of the same soil were handled individually, not pooled. All extracts obtained using either the FastPrep or the MoBio kits were diluted to 0.5 ng/uL as determined via fluorometry before amplification with the following primer sets: universal eubacterial (BACfOFRGpUSER, GGAGACAUAGRRTTTGATYHTGGYTCAG and BACrOFRGpUSER, GGGAAAGUGBTACCTTGTTACGACTT) or universal fungal (FUNfOFRGpUSER, GGAGACAUTTAGCATGGAATAATRRAATAGGA and FUNrOFRGpUSER GGGAAAGUATTGCAATGCYCTATCCCCA). These primers had been modified to work with the USER friendly cloning kit (New England Biolabs). Each PCR reaction mix contained 0.5 ng of template DNA, 50 mM Tris-HCl (pH 8.3), 2.5 mM MgCl2, 5 ug bovine serum albumin (BSA), 0.25mM dNTP, 0.4 uM forward and reverse primers and 0.5 units of Taq DNA polymerase, made up to a 10 uL total volume with nanopure deionized filtered water. PCR conditions (in capillary PCR machines) were as follows: for universal bacterial primers, 94C for 2 min, 35 cycles of 94C for 20s, 45C for 30s, 72C for 40s followed by 72C for 2 min. Conditions were identical for universal fungal primers except that the annealing temperature was 56C.
Densitometry
PCR reaction products were separated electrophoretically in 1% (w/v) agarose gels (10 mL) and TBE buffer (100V, 10 min). Low DNA Mass Ladder (LML, Invitrogen) was included as a marker on each gel, used at a density of 0.4 uL per lane. One microlitre of each PCR reaction was run in two separate lanes on the same gel. Bands were visualized after staining with ethidium bromide (10 mins in a 0.01% solution) and photographed under UV illumination. The photographs were scanned and the digital images processed as follows: Adobe PhotoShop Elements was used to invert the image and rotate it so that lanes were perfectly vertical, then Scion Image was used to generate densitometry plots using the bands in the LML lane to generate a standard curve. The slope and y-intercept of each gel standard curve were similar for most gels (data not shown), and were arbitrarily set to values of 3.0 for the slope and 0 for the y-intercept, respectively, so bands could be compared between different gels. The average ng amplified DNA for each sample was calculated and compared via ANOVA and Tukeys studentized range test using SAS statistical software.
Amplification of rDNA and generation of clone libraries for OFRG
OFRG was conducted using Powell soil only. DNA was extracted from three Powell soil subsamples using the MoBio and Bio101 kit methods as well as the manual hot detergent lysis method described above. Extracts from subsamples were handled individually, not pooled. The concentration of DNA in each extract was determined via fluorometry as described above, and extracts were diluted to a concentration of 0.5 ng/uL prior to amplification by PCR. PCR primers, reaction mix components and cycling conditions were identical to those indicated above except that reactions were scaled up to 50 uL volumes, and for bacterial primers, only 25 amplification cycles were used. For each extract, multiple 50 uL reactions were completed and pooled for a final reaction volume of 100-800 uL. Pooled reactions were concentrated to a volume of 10 uL and then run in a 10 mL 1% agarose gel for 45 min at 100V. Each band of the appropriate molecular weight was excised and the DNA recovered using a MinElute DNA Extraction kit (Qiagen).
Each purified, amplified product was used to generate a separate clone library via the USER friendly cloning kit (New England Biolabs), following the m a n u f a c t u r e r s i n s t r u c t i o n s . C l o n e s w e r e g r o w n o v e r n i g h t a t 3 7 C o n L B a g a r m e d i u m c o n t a i n i n g 1 0 0 m g / L a m p i c i l l i n , 2 0 0 m g / L I P T G ( i s o p r o p y l - - D - 1 - t h i o g a l a c t o p y r a n o s i d e ) a n d 7 0 m g / L X - g a l ( 5 - b r o m o - 4 - c h l o r o - 3 - i n d o l y l - D - g a l a c t o p y r a n o s i d e ) . A Q P i x g r i d d i n g / picking robot was used to pick 768 white clones from each clone library into 384 well culture plates containing 50 uL per well of LB medium containing 100 mg/L ampicillin and 8% (v/v) glycerol. These plates were grown overnight at 37C with 300 rpm shaking and then frozen at -80 C until use. Control clone libraries consisting of 96 clones of known sequence replicated four times on a single 384 well plate were constructed both for fungal and for bacterial rDNA sequences, using the same vector.
Generating macroarrays
One macroarray was generated with bacterial rDNA clones and one with fungal rDNA clones. For each macroarray, 9,600 cloned sequences were amplified via PCR, then gridded onto nylon membranes using a gridding robot.
To provide template for PCR, frozen bacterial or fungal clone libraries were thawed, consisting of 24 clone library plates and one control clone plate, were thawed completely on ice. An ethanol-sterilized 384 pin replicator was used to add 1 uL of clone suspension to each well of 384 well culture plates containing 40 uL per well of LB broth containing 100 mg/L ampicillin. Plates were incubated at 37C without shaking for 7 hours followed by 16-18 hours of rotary shaking at 300 rpm.
A PCR master mix of 180 mL (containing 500 mM Tris-HCl (pH 8.3), 2.5 mM MgCl2, 90 mg BSA, 0.25mM dNTP, 0.4 uM forward (UserOFRGFor2, TCGAGCTCAGGCGCGCCTTATTAAGCTGA) and reverse (UserOFRGRev2, GCCAAGCTTCCTGCAGGGTTTAAACGCTGA) primers and 9000 units of Taq DNA polymerase) was prepared in a sterile DNA-free media bottle and used to fill 25 384-well PCR plates (TempTec, Eppendorf) with 15 uL per well via an AliQuot autosampler (Genetix). PCR plates were kept at 4C for as much as possible during the inoculation process. Each plate was inoculated with 1 uL of clone suspension using a 384 pin replicator. The pin replicator was blotted on Whatman filter paper, rinsed in nanopure deionized water and finally dipped in 95% ethanol, flamed and dried thoroughly between plates. Immediately after inoculation, PCR plates were sealed with heat sealing foil (Thermo-Seal, Marsh Bio-Products) and a Combi Thermo-Sealer. Sealed PCR plates were kept at 4C after inoculation until immersion in waterbaths.
All 25 PCR plates were secured in a homemade weighted rack and manually transferred between two waterbaths, one kept at 94 C and the other kept at 72 C, each at a depth so that when immersed there would be at least one inch of water above the rack. Plates were incubated as follows: 94 C for 10 mins, followed by 35 cycles of 94 C for 1 min, 72 C for 2 mins, then finally 72 C for 5 mins. Plates were submerged in ice following waterbath PCR and then stored at 4C until use.
Four plates were chosen randomly and 1uL of eight PCR reactions from each of these plates were separated electrophoretically on an agarose gel and visualized as described previously. Gridding did not proceed unless most of the 32 reactions contained a bright band of amplified DNA.
A QPix (Genetix) picking/gridding robot with a 384 pin gridding head was used to spot DNA onto 24 cm2 nylon (Hybond N+, Amersham) membranes. Each membrane was fixed atop a single thickness of dry Whatman filter paper. Forty-eight identical macroarrays of 9,600 PCR reactions were generated, with the 25 PCR plates each occupying one position in a 5X5 subgrid. Each position was spotted 6 times. After gridding, membranes were cross-linked (70 mJ) with exposure to UV light. Membranes were kept at room temperature until used in hybridizations.
Oligonucleotide probe hybridizations
One probe was hybridized to one membrane. Membranes were placed atop Whatman filter paper saturated with enough denaturation solution (0.5 M NaOH + 1.5 M NaCl) to moisten the membranes and incubated at room temperature for 5 minutes. This was repeated one more time with fresh filter paper and solution. Following that, a similar incubation was conducted for 3 min with neutralization solution (50 mM sodium phosphate pH 7.2) a total of three times. Membranes were then placed in containers to which boiling 0.01% (w/v) SDS was added. The SDS solution was allowed to cool before membranes were removed and placed in hybridization tubes (3.5 cm ID X 15 cm l) containing 5 mL of hybridization buffer (600 mM NaCl, 60 mM sodium citrate, 7.2% sarkosyl).
Membranes were incubated on a rotisserie at 11C for 30 min, after which labeled oligonucleotide probes were added (one probe per bottle). Table 2 lists the oligonucleotide probes used in this study. Each probe was labeled with P33 as follows: a 10 uL reaction mix (containing 1 M oligonucl e o t i d e p r o b e , 0 . 0 0 6 5 u n i t s p o l y n u c l e o t i d e k i n a s e ( P N K , P r o m e g a ) , 1 u L P N K 1 0 X b u f f e r ( P r o m e g a ) a n d 1 5 C i g a m m a - P 3 3 - A T P ) w a s i n c u b a t e d a t 3 7 C f o r 3 0 m i n . A f t e r 3 0 m i n , t h e e n t i r e r e a c t i o n w a s i m m e d i a t e l y p l a c e d i n t o t h e h y b r i d i z a t i o n s o l u t i o n i n a b o t t l e c ontaining a preincubated membrane, and the hybridization conducted at 11C for 16 hours.
Each membrane was washed twice with SSC buffer (3 M NaCl and 0.3M sodium citrate for a 20X SSC solution) kept at 11C at the buffer concentration and for the number of minutes indicated for each probe in Table 2. Each membrane was then exposed to a phosphoimaging screen for 5 or 16-18 hours and an image obtained with a BioRad Molecular Imager FX.
Quantification and analysis of images
Clone spot intensities were quantified using ImaGene v. 6.0 software. Quantified image data was analyzed using software developed at the University of California, Riverside, which can be obtained by contacting James Borneman ( HYPERLINK "mailto:james.borneman@ucr.edu" james.borneman@ucr.edu) or Tao Jiang (tao.jiang@ucr.edu). Background intensity values for each clone were subtracted from signal intensity values. Ratios of the background-subtracted signals from the differential probes divided by the background-subtracted signals for the reference probe were determined. Ratio values (RV) were used to take into account variation in signal intensity in the macroarray due to variation in PCR amplification between wells, and evaporation from plates during the membrane printing process.
Fingerprint values of 0 (no probe binding), 1 (probe binding) and n (indeterminate) were assigned to each clone based on the values x and y which were determined individually for each probe, and where all clones with RV < x are designated 0, all clones with RV > y are designated 1 and all clones with RV between x and y are designated n. The values of x and y were determined via an iterative analysis of 384 control clone RVs, which are clones of known sequence that are represented four times in the array on the control plate. The RV of each control clone spot was assigned theoretically negative (0) or positive (1) values based on whether the sequence of the clone should bind the probe or not. The values of x and y were chosen so that the range of n clones was minimized and the percentage of 0 clones with RV < x and 1 clones with RV > y were maximized (minimum allowable percentage was set at 97% for the eubacterial array and 100% for the fungal array).
Once fingerprints were assigned, the clones were grouped according to fingerprint, with each fingerprint representing an OTU. The fingerprinting process has previously been shown to group sequences with pairwise identities of 97% (eubacteria) and 99.2% (fungi) together ADDIN EN.CITE Valinsky200240619WP-0078 619WP: Document Delivery availableValinsky, L.Della Vedova, G.Jiang, T.Borneman, J.Oligonucleotide fingerprinting of rRNA genes for analysis of fungal community compositionApplied & Environmental Microbiology68125999-60042002Gradient gel-electrophoresis. Polymerase chain-reaction. Molecularmicrobial diversity. 18s rdna. Microorganisms. Environment. Primers.Roots. Soil. View.Biology in Current Contents(R)/Agricultural, Biology & EnvironmentalSciencesMicrobiology in Current Contents(R)/Life Sciences.2003 week 01Reprint available from: Borneman J. Univ Calif Riverside, Dept PlantPathol, Riverside, CA 92521, USA, .Valinsky200250569YV-0063 569YV: Document Delivery availableValinsky, L.Della Vedova, G.Scupham, A. J.Alvey, S.Figueroa, A.Yin, B.Hartin, J.Chrobak, M.Crowley, D. E.Jiang, T.Borneman, J.Analysis of bacterial community composition by oligonucleotide fingerprinting of rRNA genesApplied & Environmental Microbiology6873243-3250200216s ribosomal-rna. Molecular microbial diversity. Array hybridization.Probes. Soil. Identification. Microorganisms. Libraries. Dna.Biology in Current Contents(R)/Agricultural, Biology & EnvironmentalSciencesMicrobiology in Current Contents(R)/Life Sciences.2002 week 31Reprint available from: Borneman J. Univ Calif Riverside, Dept PlantPathol, Riverside, CA 92506, USA, .(17, 18). For the bacterial and fungal fingerprints, 4.4 % and 4.9% of the fingerprint digits consisted of ns, respectively.
OTUs were identified in two ways: (1) by matching the fingerprints of identified organism sequences to those of sequences in an OTU and sequencing a few clones in that OTU to verify the similarity of clone sequences to those from known organisms, or, where no identified organism sequences matched a particular fingerprint (2) choosing some clones from that group, sequencing them and comparing the sequences to public database information.
References
QUOTE EN.REFLIST 1. Blackwood, C. B., T. Marsh, S.-H. Kim, and E. A. Paul. 2003. Terminal restriction fragment length polymorphism data analysis for quantitative comparison of microbial communities. Applied & Environmental Microbiology 69:926-932.
2. Chabrerie, O., K. Laval, P. Puget, S. Desaire, and D. Alard. 2003. Relationship between plant and soil microbial communities along a successional gradient in a chalk grassland in north-western France. Applied Soil Ecology 24:43-56.
3. Chow, M. L., C. C. Radomski, J. M. McDermott, J. Davies, and P. E. Axelrood. 2002. Molecular characterization of bacterial diversity in lodgepole pine (Pinus contorta) rhizosphere soils from British Columbia forest soils differing in disturbance and geographic source. FEMS Microbiology Ecology 42:347-357.
4. Courtios, S., C. M. Cappellano, M. Ball, F.-X. Francou, P. Normand, G. Helynck, A. Martinez, S. J. Kolvek, J. Hopke, M. S. Osburne, P. R. August, R. Nalin, M. Guerineau, P. Jeannin, P. Simonet, and J.-L. Pernodet. 2003. Recombinant environmental libraries provide access to microbial diversity for drug discovery from natural products. Applied & Environmental Microbiology 69:49-55.
5. de Boer, W., P. Verheggen, P. Gunnewiek, G. A. Kowalchuk, and J. A. van Veen. 2003. Microbial community composition affects soil fungistasis. Applied and Environmental Microbiology 69:835-844.
6. Gee, G. W., and J. W. Bauer. 1982. Particle-size analysis. In A. Klute (ed.), Methods of soil analysis: Part 1. Physical and mineralogical methods. ASA Monograph Number 9.
7. Junca, H., and D. H. Pieper. 2004. Functional gene diversity analysis in BTEX contaminated soils by means of PCR-SSCP DNA fingerprinting: comparative diversity assessment against bacterial isolates and PCR-DNA clone libraries. Environmental Microbiology 6:95-110.
8. Kabir, S., N. Rajendran, T. Amemiya, and K. Itoh. 2003. Quantitative measurement of fungal DNA extracted by three different methods using real-time polymerase chain reaction. Journal of Bioscience and Bioengineering 96:337-343.
9. Liles, M. R., B. F. Manske, S. B. Bintrim, J. Handelsman, and R. M. Goodman. 2003. A census of rRNA genes and linked genomic sequences within a soil metagenomic library. Applied & Environmental Microbiology 69:2684-2691.
10. Nelson, D. W., and L. E. Sommers. 1982. Total carbon, organic carbon and organic matter, p. 539-579. In A. L. Page (ed.), Methods of soil analysis: Part 2. Chemical and microbiological properties. ASA Monograph Number 9.
11. Prosser, J. I. 2002. Molecular and functional diversity in soil micro-organisms. Plant and Soil 244:9-17.
12. Ranjard, L., D. P. H. Lejon, C. Mougel, L. Schehrer, D. Merdinoglu, and R. Chaussod. 2003. Sampling strategy in molecular microbial ecology: influence of soil sample size on DNA fingerprinting analysis of fungal and bacterial communities. Environmental Microbiology 5:1111-1120.
13. Ranjard, L., F. Poly, J. C. Lata, C. Mougel, J. Thioulouse, and S. Nazaret. 2001. Characterization of bacterial and fungal soil communities by automated ribosomal intergenic spacer analysis fingerprints: Biological and methodological variability. Applied and Environmental Microbiology 67:4479-4487.
14. Selenska-Pobell, S., G. Kampf, K. Flemming, G. Radeva, and G. Satchanska. 2001. Bacterial diversity in soil samples from two uranium waste piles as determined by rep-APD, RISA and 16s rDNA retrieval. Antonie van Leeuwenhoek 79:149-161.
15. Stach, J. E. M., S. Bathe, J. P. Clapp, and R. G. Burns. 2001. PCR-SSCP comparison of 16s rDNA sequence diversity in soil DNA obtained using different isolation and purification methods. FEMS Microbiology Ecology 36:139-151.
16. Staff, U. S. S. L. 1954. pH reading of saturated soil paste. In L. A. Richards (ed.), Diagnosis and improvement of saline and alkali soils. USDA Agricultural Handbook 60. U.S. Government Printing Office, Washington, D.C.
17. Valinsky, L., G. Della Vedova, T. Jiang, and J. Borneman. 2002. Oligonucleotide fingerprinting of rRNA genes for analysis of fungal community composition. Applied & Environmental Microbiology 68:5999-6004.
18. Valinsky, L., G. Della Vedova, A. J. Scupham, S. Alvey, A. Figueroa, B. Yin, J. Hartin, M. Chrobak, D. E. Crowley, T. Jiang, and J. Borneman. 2002. Analysis of bacterial community composition by oligonucleotide fingerprinting of rRNA genes. Applied & Environmental Microbiology 68:3243-3250.
19. Yin, B., L. Valinsky, X. Gao, J. Becker, and J. Borneman. 2003. Bacterial rRNA genes associated with soil suppressiveness against the plant-parasitic nematode Heterodera schachtii. Applied & Environmental Microbiology 69:1573-1580.
20. Yin, B., L. Valinsky, X. Gao, J. Becker, and J. Borneman. 2003. Identification of fungal rDNA associated with soil suppressiveness against Heterodera schachtii using oligonucleotide fingerprinting. Phytopathology 93:1006-1013.
21. Zhou, J., M. A. Bruns, and J. M. Tiedje. 1996. DNA recovery from soils of diverse composition. Applied & Environmental Microbiology 62:316-322.
22. Zhou, J., B. Xia, H. Huang, A. V. Paulumbo, and J. M. T i e d j e . 2 0 0 4 . M i c r o b i a l d i v e r s i t y a n d h e t e r o g e n e i t y i n s a n d y s u b s u r f a c e s o i l s . A p p l i e d &